Home page > Legionella pneumophila > Legionella pneumophila support > Utilities

Help file for allele assignment

The Legionella pneumophila database presents published data compiled from the litterature. It also comprises data assembled from available whole genome sequence data. The rational for using such data is described in the Brauschweig poster. While we have done our best to harmonize the typing conventions, the database is provided as is.

Four MLVA panels are defined in the database, MLVA8, MLVA10, MLVA12 and MLVA13, selected from 14 loci. Other selections can be defined to suit local needs. The typing convention for each of the loci is summarized below:

Lp01_45bp_565bp_8U ACGRGCATATGACAAAGCCTTG CGGATCATCAGGTATTAATCGC

Lp03_96bp_941bp_8U CAACCAATGAAGCAAAAGCA RGGGSTTGATGGTCTCAATG

Lp13_24bp_428bp_11U CAATWGCATCGGACTGAGYA TGCCTGTGTATCTGGRAARGC

Lp17_39bp_278bp_2U CRGCTCACCYCGTATCACTT TAACATCAATGACCGCGAAA

Lp19_21bp_173bp_4U GAACTATCAGAAGGAGGCGAT GGAGTTTGACTYGGCTCAGG

Lp31_45bp_948bp_17U GCAATCCGGCCTCGCAAGCC CAGGCACACCTTGGCCGTCA

Lp33_125bp_227bp_1U ACCACAGCAGTTTGAACATAAT GGRAGAAGTTATAGATCTATTCG

Lp34_125bp_209bp_1U GAAAAGGAATAAGGCGCAGCAC AAACCTCGTTGGCCCCTCGCTT

Lp35_18bp_202bp_3U CTGAAACAGTTGAGGATGYGA TTATCAACCTCATCATCCCTG

Lp37_7bp_200bp_13U GCTTTTGTTTYACTTAATTGCTAC GAATAAATATTYCYTTTTAAGCTAC

Lp38_264bp_8bp_3U CCTATCAACAGATGACGCTT GGATTGCCTTGGGCATTAAT

Lp39_79bp_6bp_6U CTTGACGAAGTAGGTGTGGG CCAACTCCTCDACGCAACAA

Lp40_198bp_6bp_4U TAGATCTCTTGCCGAGCTTC TTACCCAAGCCCTTATTGCG

Lp44_173bp_6bp_9U GCTACTGCAGCAACATCC TTATGCGAGAGTTTCATGA

(where Y=C or T; R=A or G; D=A, G, or T; S=C or G; W=A or T)

MLVA8 uses all loci except for Lp31 and Lp37 to Lp44. MLVA10 uses all loci except Lp38 to Lp44. MLVA12 uses all loci except Lp17 and Lp37. MLVA13 uses all loci except Lp37.

This list indicates for each locus the repeat unit size, the predicted PCR product size and the corresponding repeat copy number in the Legionella pneumophila Philadelphia 1 sequenced genome refseq NC_002942 when using the indicated primers. For instance the MLVA8 code for this genome is 8 8 11 2 4 1 1 3.

It is important to keep in mind that this copy number is a convention. The "true" repeat copy number at a given locus may be 4.5, 5.5 etc. A convention is a decision on how to round up such values. The convention has no impact on data quality, only the same convention needs to be applied before merging data sets produced by different groups. Also different groups might want to use different primers, for good reasons such as PCR multiplexing. This is likely to change the expected PCR product size, but should not change the corresponding repeat copy number.

The source for each data is indicated in the "publication" column, further inquiries should be sent to the corresponding author of the associated publication ("contact" column).

To see the table for allele assignment for the loci which can be typed using agarose gels, click here

Allele assignment Table version 1.1 - 24.8 kb

Provides correspondence table between size and repeat copy numbers

In silico Legionella genotyping database - 311.4 kb

Poster presented in Braunschweig, Germany, International symposium on Legionella pneumophila, september 6-7th 2016